View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_265 (Length: 233)
Name: NF1498_high_265
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_265 |
 | |
|
| [»] scaffold0955 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 25306446 - 25306665
Alignment:
| Q |
1 |
cttgaaaccagatgaaagtcattgttcaccctttgatatt-agatgcttacgtcggtgatttggtgaactttcttttgatgagcaacaattttggcagtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25306446 |
cttgaaaccagatgaaagtcattgttcaccctttgatatttagatgcttacgtcggtgatttggtgaactttcttttgatgagcaacaattttggcagtg |
25306545 |
T |
|
| Q |
100 |
acaagccaatgaatgccatgctctcttgcaagtcctgtttcatattgcccctcaatactactactatcactactactaatgatgataatgttggtaagct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25306546 |
acaagccaatgaatgccatgctctcttgcaagtcctgtttcatattgcccctcaatactactactatcactactactaatgatgataatgttggtaagct |
25306645 |
T |
|
| Q |
200 |
ctagaatcagcacccatact |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25306646 |
ctagaatcagcacccatact |
25306665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 100 - 193
Target Start/End: Original strand, 25443750 - 25443843
Alignment:
| Q |
100 |
acaagccaatgaatgccatgctctcttgcaagtcctgtttcatattgcccctcaatactactactatcactactactaatgatgataatgttgg |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25443750 |
acaagccaatgaatcccatgctctcttgcaagtcctgtttcatattgcccctcaatactactactatcactactactaatgatgataatgttgg |
25443843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0955 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0955
Description:
Target: scaffold0955; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 132
Target Start/End: Original strand, 2483 - 2515
Alignment:
| Q |
100 |
acaagccaatgaatgccatgctctcttgcaagt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2483 |
acaagccaatgaatgccatgctctcttgcaagt |
2515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University