View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_270 (Length: 227)
Name: NF1498_high_270
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_270 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 6788630 - 6788826
Alignment:
| Q |
13 |
gaagaatatggaccgttcgattaaggtcagacgataacacccctaaagatcgaggaaattacaataaagccaaaaatagcaaaagaaacgaggaccgttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6788630 |
gaagaatatggaccgttcgattaaggtcaggcgataacacccctaaagatcgaggaaattacaataaagccaaaaatagcaaaagaaacgaggaccgttg |
6788729 |
T |
 |
| Q |
113 |
gatcaaggtcagacgataaaacccccaaagatgaacaaaattacaaaagagacaacattgaaaatgcagaatgatagtggcaatataggaagaaaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6788730 |
gatcaaggtcagacgataaaacccccaaagatgaacaaaattacaaaagagacaacattgaaaatgcagaatgatagtggcaatataggaagaaaac |
6788826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University