View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_293 (Length: 213)
Name: NF1498_high_293
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_293 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 22863335 - 22863157
Alignment:
| Q |
20 |
ccggtgaccggaaatacgagtgtcaatattgttgtcgagaatttgcaaactcacaagccctaggtggacaccaaaacgcacacaaaaaagagcgccaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22863335 |
ccggtgaccggaaatacgagtgtcaatattgttgtcgagaatttgcaaactcgcaagccctaggtggacaccaaaacgcacacaaaaaagagcgccaaca |
22863236 |
T |
|
| Q |
120 |
actcaaacgagcacagttacaagcttcaagaaacgctgccgtttcgtttgttcgaaacccgattatctccgcctttgct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22863235 |
actcaaacgagcacagttacaagcttcaagaaacgctgccgtttcgtttgttcgaaacccgattatctccgcctttgct |
22863157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 31 - 205
Target Start/End: Original strand, 49774313 - 49774487
Alignment:
| Q |
31 |
aaatacgagtgtcaatattgttgtcgagaatttgcaaactcacaagccctaggtggacaccaaaacgcacacaaaaaagagcgccaacaactcaaacgag |
130 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||| ||||||||||| || |||||||||||||| ||||||||||| || |||||||||||||| | |
|
|
| T |
49774313 |
aaatacgagtgccaatattgttgcagagagtttgcaaattcacaagcccttggcggacaccaaaacgctcacaaaaaagaacgtcaacaactcaaacgtg |
49774412 |
T |
|
| Q |
131 |
cacagttacaagcttcaagaaacgctgccgtttcgtttgttcgaaacccgattatctccgcctttgctactccac |
205 |
Q |
| |
|
| |||||||||||| ||||||| ||||| || || ||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
49774413 |
ctcagttacaagctaaccgaaacgccgccgtgtctttcgttcgaaaccctatcatctccgcctttgctcctccac |
49774487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 33 - 111
Target Start/End: Complemental strand, 31520047 - 31519969
Alignment:
| Q |
33 |
atacgagtgtcaatattgttgtcgagaatttgcaaactcacaagccctaggtggacaccaaaacgcacacaaaaaagag |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||| |||| ||||||||||| |||||||| |||||| |
|
|
| T |
31520047 |
atacgagtgtcaatattgttgtagagaatttgcaaattcacaagccttaggaggacaccaaaatgcacacaagaaagag |
31519969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University