View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_high_304 (Length: 202)

Name: NF1498_high_304
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_high_304
NF1498_high_304
[»] chr5 (1 HSPs)
chr5 (43-189)||(5413445-5413588)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 43 - 189
Target Start/End: Original strand, 5413445 - 5413588
Alignment:
43 tttaccttactttttccccgaaaagttaatgcaagaagactaatcaccaacaacatagataaattttggatctataaagtaagtaaaattttaaatgagc 142  Q
    ||||||||||||||||||    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||    
5413445 tttaccttactttttcccg---aagttattgcaagaagactaatcaccaacaacatagataaattttggatctataaagtaagtaaaatttaaaatcagc 5413541  T
143 aaattaatggctattgttttaacaaacttataatttatgatgatgaa 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
5413542 aaattaatggctattgttttaacaaacttataatttatgatgatgaa 5413588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University