View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_304 (Length: 202)
Name: NF1498_high_304
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_304 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 43 - 189
Target Start/End: Original strand, 5413445 - 5413588
Alignment:
| Q |
43 |
tttaccttactttttccccgaaaagttaatgcaagaagactaatcaccaacaacatagataaattttggatctataaagtaagtaaaattttaaatgagc |
142 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
5413445 |
tttaccttactttttcccg---aagttattgcaagaagactaatcaccaacaacatagataaattttggatctataaagtaagtaaaatttaaaatcagc |
5413541 |
T |
 |
| Q |
143 |
aaattaatggctattgttttaacaaacttataatttatgatgatgaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5413542 |
aaattaatggctattgttttaacaaacttataatttatgatgatgaa |
5413588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University