View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_305 (Length: 202)
Name: NF1498_high_305
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_305 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 14051931 - 14052101
Alignment:
| Q |
19 |
gctatggggtacctggcaccagaatacacaacaaccggtcgtttcaccgaaaagagtgacgtgtacgctttcggggtgatcgttttccagattctcactg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
14051931 |
gctatggggtacctggcaccagaatacacaacaaccggtcgtttcaccgaaaagagtgatgtgtacgctttcgggatgattgttttccagattctcactg |
14052030 |
T |
 |
| Q |
119 |
gaaaacacaatatcactcaattaagtcgtcaatgtgtagaaaccggtagtttgaaagatattattgatgag |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
14052031 |
gaaaacacgatatcactcaattaagtcgtcaatgtgtagaaactggtactttgaaagatattattgatgag |
14052101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 14361959 - 14362129
Alignment:
| Q |
19 |
gctatggggtacctggcaccagaatacacaacaaccggtcgtttcaccgaaaagagtgacgtgtacgctttcggggtgatcgttttccagattctcactg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
14361959 |
gctatggggtacctggcaccagaatacacaacaaccggtcgtttcaccgaaaagagtgatgtgtacgctttcgggatgattgttttccagattctcactg |
14362058 |
T |
 |
| Q |
119 |
gaaaacacaatatcactcaattaagtcgtcaatgtgtagaaaccggtagtttgaaagatattattgatgag |
189 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
14362059 |
gaaaacacgatatcactcaattaagtcgtcaatgtgtagaaactggtactttgaaagatattattgatgag |
14362129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University