View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_33 (Length: 555)
Name: NF1498_high_33
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 22191067 - 22191280
Alignment:
| Q |
10 |
aagaaaataaattatataaactatgaataggtttataactacggcattttcaatttctgctttggcacttcttttctaggcatgtgaaacttctaaataa |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191067 |
aagaaaataaattatataaactatcaataggtttataactacggcattttcaatttctgctttggcacttcttttctaggcatgtgaaacttctaaataa |
22191166 |
T |
|
| Q |
110 |
gtgactggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctcttttatggatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22191167 |
gtgactggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctctttgatggatt |
22191266 |
T |
|
| Q |
210 |
gtaagacattattt |
223 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
22191267 |
gtaagactttattt |
22191280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 434 - 487
Target Start/End: Original strand, 22191336 - 22191389
Alignment:
| Q |
434 |
ttgttgagaaatgcaattaatcaaggttatcaaaatcaaatctaccagtttgat |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191336 |
ttgttgagaaatgcaattaatcaaggttatcaaaatcaaatctaccagtttgat |
22191389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 506 - 541
Target Start/End: Original strand, 22191422 - 22191457
Alignment:
| Q |
506 |
ccagatgtatgttcggccccatcaaccatgaaactg |
541 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22191422 |
ccagatgtatgttcggccccatcaaccatgaaactg |
22191457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 228 - 272
Target Start/End: Original strand, 6983341 - 6983385
Alignment:
| Q |
228 |
atttattttcaaatgcatctctgatattaccaatttaatgtcatc |
272 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
6983341 |
atttattttcaaattcatctcctatattaccaacttaatgtcatc |
6983385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University