View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_54 (Length: 445)
Name: NF1498_high_54
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 295 - 436
Target Start/End: Complemental strand, 34259021 - 34258880
Alignment:
| Q |
295 |
ctgagcgtaggtggttcgagggttggcatcgaggttcctgctaagaaggatttgaacaatgctagagcaagttttggtctatgcagaggaacttcgtgcc |
394 |
Q |
| |
|
||||| ||||||||||| || ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34259021 |
ctgagggtaggtggttcaagcgtttgcatcgaggttcctgccaagaaggatttgaacaatgctagagcaagttttggtctatgcagaggaacttcgtgcc |
34258922 |
T |
 |
| Q |
395 |
ctgcaccccttacatttacaaacgtgagtccggcatattctt |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34258921 |
ctgcaccccttacatttacaaacgtgagtccggcatattctt |
34258880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 146 - 294
Target Start/End: Complemental strand, 34259192 - 34259046
Alignment:
| Q |
146 |
gatgaccacttcgtgtttcttttaaaacaagacatatcagcgctcgtggatatccctaaattgtgctccacagcattgctgcaaaaatattattgatgaa |
245 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| | ||| |
|
|
| T |
34259192 |
gatgaccacttcgtgtttctta-aaaactagacatatc-gcgctcgtggatatccctaaattgtgctccatagcattgctacaaaaatattattcaagaa |
34259095 |
T |
 |
| Q |
246 |
tattccatggaaaacaaagacaaactgcaaagtaacaaccctaaacttg |
294 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34259094 |
tattccatggaaaccaaacacaaactgcaatgtaacaaccctaaacttg |
34259046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 305 - 436
Target Start/End: Complemental strand, 26645539 - 26645408
Alignment:
| Q |
305 |
gtggttcgagggttggcatcgaggttcctgctaagaaggatttgaacaatgctagagcaagttttggtctatgcagaggaacttcgtgccctgcacccct |
404 |
Q |
| |
|
||||||| || |||||||| ||||||||||||||||||| ||||| ||||| ||| ||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
26645539 |
gtggttcaagagttggcatggaggttcctgctaagaaggctttgatcaatgttagcgcaagttttggtctatgcagaggaacttcatgcccggcacccct |
26645440 |
T |
 |
| Q |
405 |
tacatttacaaacgtgagtccggcatattctt |
436 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
26645439 |
tacatttacaaacgtgagtccggcgtattctt |
26645408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 305 - 436
Target Start/End: Complemental strand, 26631733 - 26631602
Alignment:
| Q |
305 |
gtggttcgagggttggcatcgaggttcctgctaagaaggatttgaacaatgctagagcaagttttggtctatgcagaggaacttcgtgccctgcacccct |
404 |
Q |
| |
|
||||||| || |||||||| ||||||||| ||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26631733 |
gtggttcaagagttggcatggaggttccttctaagaaggctttgatcaatgttagagcaagttttggtctatgcagaggaacttcgtgccctgcacccct |
26631634 |
T |
 |
| Q |
405 |
tacatttacaaacgtgagtccggcatattctt |
436 |
Q |
| |
|
||| || ||||| ||||||||||| ||||||| |
|
|
| T |
26631633 |
tacgttaacaaatgtgagtccggcgtattctt |
26631602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 305 - 436
Target Start/End: Complemental strand, 26639574 - 26639443
Alignment:
| Q |
305 |
gtggttcgagggttggcatcgaggttcctgctaagaaggatttgaacaatgctagagcaagttttggtctatgcagaggaacttcgtgccctgcacccct |
404 |
Q |
| |
|
||||||| || |||||||| ||||||||| ||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26639574 |
gtggttcaagagttggcatggaggttccttctaagaaggctttgatcaatgttagagcaagttttggtctatgcagaggaacttcgtgccctgcacccct |
26639475 |
T |
 |
| Q |
405 |
tacatttacaaacgtgagtccggcatattctt |
436 |
Q |
| |
|
||| || ||||| ||||||||||| ||||||| |
|
|
| T |
26639474 |
tacgttaacaaatgtgagtccggcgtattctt |
26639443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 127
Target Start/End: Complemental strand, 34259328 - 34259226
Alignment:
| Q |
20 |
ataatgactaaaaatcaataggtagagtttttct--gtcaccatgttaatgtttccaccgctgtttaacacacgaaaaaatgtttattgtttgttaagaa |
117 |
Q |
| |
|
||||||| |||||||||||| |||| |||||| | |||||| |||||| ||||||| | ||||||||||| |||||||||||||||||| ||| |
|
|
| T |
34259328 |
ataatgagtaaaaatcaataagtagtgtttttttttgtcaccgtgttaaagtttccagcactgtttaacac-------aatgtttattgtttgttatgaa |
34259236 |
T |
 |
| Q |
118 |
tgtaattaac |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
34259235 |
tgtaattaac |
34259226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University