View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_56 (Length: 437)
Name: NF1498_high_56
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 5e-72; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 255 - 423
Target Start/End: Original strand, 24883472 - 24883647
Alignment:
| Q |
255 |
aatctgtttcatttcttcattttccatttgtaaacttatcatactctctccatagtatgatatcttgtgcagatcaaaataataaatgggcttcttacgc |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24883472 |
aatctgtttcatttcttcattttccatttggaaacttatcatactctctccatagtatgatatcttgcgcagatcaaaataataaatgggcttcttacgc |
24883571 |
T |
|
| Q |
355 |
tggacctggaggatggaatggtaaacatcctaataata-------tgtctatgatccctatttactatatcatatt |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
24883572 |
tggacctggaggatggaatggtaaacatcctaataatatactatttctctatgatccctatttactatatcatatt |
24883647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 24883384 - 24883447
Alignment:
| Q |
1 |
tgggaaatagttggagaacaacatcagatatcgaagataaatgggataggtgaggatcaatgat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883384 |
tgggaaatagttggagaacaacatcagatatcgaagataaatgggataggtgaggatcaatgat |
24883447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 336 - 378
Target Start/End: Complemental strand, 32590408 - 32590366
Alignment:
| Q |
336 |
ataaatgggcttcttacgctggacctggaggatggaatggtaa |
378 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
32590408 |
ataaatgggcatcttatgctggacctggaggatggaatggtaa |
32590366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 338 - 378
Target Start/End: Complemental strand, 32600854 - 32600814
Alignment:
| Q |
338 |
aaatgggcttcttacgctggacctggaggatggaatggtaa |
378 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
32600854 |
aaatgggcatcttatgctggacctggaggatggaatggtaa |
32600814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 32601093 - 32601043
Alignment:
| Q |
1 |
tgggaaatagttggagaacaacatcagatatcgaagataaatgggataggt |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||| |||||| |
|
|
| T |
32601093 |
tgggaaatagttggagaacaacaggagatattgaagataactggaataggt |
32601043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 338 - 378
Target Start/End: Complemental strand, 34578166 - 34578126
Alignment:
| Q |
338 |
aaatgggcttcttacgctggacctggaggatggaatggtaa |
378 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
34578166 |
aaatgggcatcttatgctggacctggaggatggaatggtaa |
34578126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 335 - 378
Target Start/End: Complemental strand, 34593959 - 34593916
Alignment:
| Q |
335 |
aataaatgggcttcttacgctggacctggaggatggaatggtaa |
378 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
34593959 |
aataaatgggcatcgtatgctggacctggaggatggaatggtaa |
34593916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University