View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_high_64 (Length: 428)
Name: NF1498_high_64
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 364
Target Start/End: Complemental strand, 29405686 - 29405342
Alignment:
| Q |
18 |
gtatttaaggtttcatctgctccttcgagtgaagttgaaaccggtaaacagacgaagcatcacgggaatccgaagagatcagagagatccgaggaaatcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29405686 |
gtatttaaggtttcatctgctccttcgagtgaagttgaaaccggtaaacagacgaagcatcaggggaatccgaagagatcagagagatctgaggaaatcg |
29405587 |
T |
 |
| Q |
118 |
gtgatcttgattttcacatgtctactagtgcaaagtatcttcttatttcagcttttcttgcctctagaaaccctgctactcttgatgcttcactttttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405586 |
gtgatcttgattttcacatgtctactagtgcaaagtatcttcttatttcagcatttcttgcctctagaaaccctgctactcttgatgcttcactttttga |
29405487 |
T |
 |
| Q |
218 |
ttccaaaggtggttctgataatcgaaagcgaaagaggaagtaagtatggcaatttcgaactattttttgatgtgctgaaaacaatattgtgtatgaattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
29405486 |
ttccaaaggtggttctgataatcgaaagcgaaagaggaagtaagtatggcaatttcgaactatttttttatgtgctgaaaacaata--gtgtatgaattt |
29405389 |
T |
 |
| Q |
318 |
ttgagactttaatacttctttataactcgaatgaagcctcttgttgg |
364 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29405388 |
ttgagactttaatacttctttattactcgaatgaagcctcttgttgg |
29405342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University