View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_107 (Length: 367)
Name: NF1498_low_107
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_107 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 14 - 168
Target Start/End: Original strand, 42656479 - 42656634
Alignment:
| Q |
14 |
agataggtgatctaatttattactatgtactttgtcttttatcatttttgtctctatattataagttgtcagcttcaaaacaagcagtacgtacaaa-ta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
42656479 |
agataggtgatctaatttattactatgtactttgtcttttatcatttttgtctctatatgataagttgtcagcttcaaaacaagcggtacgtacaaatta |
42656578 |
T |
|
| Q |
113 |
cagttgtcaattttatttacagtggattatgtaaaaaaacaatttcctaaaaatac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42656579 |
cagttgtcaattttatttacagtggattatgtaaaaaaacaatttcctaaaaatac |
42656634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 42656782 - 42656829
Alignment:
| Q |
225 |
aaacaataatcatactatggaattattatttttggttatacactgttg |
272 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42656782 |
aaacaataatcatactattgaattattatttttggttatacactgttg |
42656829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University