View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_114 (Length: 359)
Name: NF1498_low_114
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 52076602 - 52076863
Alignment:
| Q |
19 |
ttcggtgtcttgtttgactttgaagagaacgatgtgttctatggtttgggatttggaatgagttgttgacatggttttgattgaag---aagatcttgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52076602 |
ttcggtgtcttgtttgactttgaagagaacgatgtgttctatggtttgggatttggaatgagttgttgacatggttttgattgaagaagaagatcttgat |
52076701 |
T |
|
| Q |
116 |
ggaaatgagagaagatgtggtgtgaggtgttttgaagatgacgaggaagaaggtatgcgaagtgaaaatgaaagctgcgttctcagacacaacatcgttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52076702 |
ggaaatgagagaagatgtggtgtgaggtgttttgaagatgacgaggaagaaggtatgcgaagtgaaaatgaaagctgcgttctcagacacaacatcgttt |
52076801 |
T |
|
| Q |
216 |
acactggaaatgaatgatagtgactgggatagtgggtgactcacttgattcttgtgaatcca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52076802 |
acactggaaatgaatgatagtgactgggatagtgggtgactcacttgattcttgtgaatcca |
52076863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University