View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_126 (Length: 352)
Name: NF1498_low_126
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_126 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 9e-61; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 11 - 168
Target Start/End: Original strand, 6180552 - 6180708
Alignment:
| Q |
11 |
aagaagagtaaaataaagcagggacccttttctttcagtgnnnnnnnnnnaagcaatctttgtacatgtgcaaagaaagatcaacaaaagaaactggttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6180552 |
aagaagagtaaaataaagcagggacccttttctttcggtgtttattttt-aagcaatctttgtacatgtgcaaagaaagatcaacaaaagaaactggttg |
6180650 |
T |
 |
| Q |
111 |
gtttcactctttagtcaacgcttctgctgtggcgttgactgcgtcatcgtagacatta |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6180651 |
gtttcactctttagtcaacgcttctgctgtggcgttgactgcgtcatcgtagacatta |
6180708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 71 - 158
Target Start/End: Original strand, 6147006 - 6147093
Alignment:
| Q |
71 |
tgtacatgtgcaaagaaagatcaacaaaagaaactggttggtttcactctttagtcaacgcttctgctgtggcgttgactgcgtcatc |
158 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| ||||||||| |||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
6147006 |
tgtacatgtgaaaagaaagatcaacaaaagaagctggttagtttcactcgttagtcaacgcttctgttgtggtgttgactgcatcatc |
6147093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 233 - 289
Target Start/End: Original strand, 6180748 - 6180804
Alignment:
| Q |
233 |
atatgccttgtagccaactaccattttgactttttatcatatttgttaaacaaatta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6180748 |
atatgccttgtagccaactaccattttgactttttatcatatgagttaaacaaatta |
6180804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 72 - 109
Target Start/End: Original strand, 6189234 - 6189271
Alignment:
| Q |
72 |
gtacatgtgcaaagaaagatcaacaaaagaaactggtt |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6189234 |
gtacatgtgcaaagaaaaatcaacaaaagaaactggtt |
6189271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 287 - 336
Target Start/End: Complemental strand, 35848597 - 35848546
Alignment:
| Q |
287 |
ttagaggtatgtcaattgaacaaccac--tttgtacaatttatgggacaacc |
336 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
35848597 |
ttagaggtatgttatttgaacaaccactttttgtacaacttatgggacaacc |
35848546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University