View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_128 (Length: 349)
Name: NF1498_low_128
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 116 - 333
Target Start/End: Original strand, 1066578 - 1066792
Alignment:
| Q |
116 |
tatgctggtgctttttcaacaaaaagctatattaacctgagaagcatagaaagcgnnnnnnnnnnnnnaatatctaaagcatccgtgttttgatatatag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
1066578 |
tatgctggtgctttttcaacaaaaagctatat-aacctgaaaagcatagaaagcgttttttttaagc-actatctaaagcatccgtgttttgatttatag |
1066675 |
T |
 |
| Q |
216 |
tgatatttatgaggtgctatattttcccaattttgtagtcatggcagaatgttttgctagatagctctaattttgcattcttttgagtagaggcaccacg |
315 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||| |||||||| ||||||| ||||||| ||||| ||||| | |||||| |||||||||||||| | |
|
|
| T |
1066676 |
cgctatttatgaggtgctatattttcc-aattttgtattcatggcataatgtttggctagatggctctgatttttccttctttagagtagaggcaccatg |
1066774 |
T |
 |
| Q |
316 |
ccacggtcagctagttac |
333 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
1066775 |
ccacagtcagctagttac |
1066792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 1065670 - 1065730
Alignment:
| Q |
1 |
atgtgagacttataccaaccggcaatgacacctattgaattgttttatataacaccccgaa |
61 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1065670 |
atgtgagacttataccaaccgtcaatgacacctattgaattgttttatataacaccccgaa |
1065730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 269 - 333
Target Start/End: Original strand, 1042596 - 1042660
Alignment:
| Q |
269 |
ttgctagatagctctaattttgcattcttttgagtagaggcaccacgccacggtcagctagttac |
333 |
Q |
| |
|
|||||| || ||||| ||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1042596 |
ttgctaaatggctctgattttgccgtcttttgagtagaggcaccacgccacggtcagcttgttac |
1042660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 219 - 254
Target Start/End: Complemental strand, 6762554 - 6762519
Alignment:
| Q |
219 |
tatttatgaggtgctatattttcccaattttgtagt |
254 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6762554 |
tatttatgaggcgctatattttcccaattttgtagt |
6762519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 219 - 254
Target Start/End: Original strand, 34215463 - 34215498
Alignment:
| Q |
219 |
tatttatgaggtgctatattttcccaattttgtagt |
254 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34215463 |
tatttatgaggcgctatattttcccaattttgtagt |
34215498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University