View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_139 (Length: 335)
Name: NF1498_low_139
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_139 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 89 - 320
Target Start/End: Complemental strand, 15631160 - 15630928
Alignment:
| Q |
89 |
atgagggagatgcgaa-gtcgtgatcaagggtgggaaaagtccttggtggcttggagatgaataccctaacgagcacttgatattatcaaactagttacg |
187 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15631160 |
atgagggagatgccaaagtcgtgatcaagggtgggaaaagtccttggtggcttggagatgaataccctaacgagcacttgatattatcaaattagttacg |
15631061 |
T |
|
| Q |
188 |
tgtgcaatctatggcattcaccaaaatgagcgatactttactttgcgagatgcaaagcatgtattattggtcaagcgttccttattgagttcagtaccgc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631060 |
tgtgcaatctatggcattcaccaaaatgagcgatactttactctgcgagatgcaaagcatgtattattggtcaagcgttccttattgagttcagtaccgc |
15630961 |
T |
|
| Q |
288 |
atgcaattgatgaaatagagtagagtatctgtg |
320 |
Q |
| |
|
||||||||||| || ||||||||||||| |||| |
|
|
| T |
15630960 |
atgcaattgataaagtagagtagagtatgtgtg |
15630928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University