View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_145 (Length: 327)
Name: NF1498_low_145
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_145 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 311
Target Start/End: Complemental strand, 27836310 - 27836010
Alignment:
| Q |
10 |
tcaaaggtatgcccctctaacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtacctatgatgaaggtatttgcat |
109 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27836310 |
tcaagggtgtgcccctctaacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtgcctatgatgaaggtatttgcat |
27836211 |
T |
|
| Q |
110 |
aattgtggttaaatatgttttcaatctctataaaattacatattttttagtctctatacctactttttagtcccataaactacaaaactacacattttta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27836210 |
aattgtggttaaatatgttttcaatctctataaaattacatattttttagtctctatacctactttttagtcccataaactacaaaactacacattttta |
27836111 |
T |
|
| Q |
210 |
gtccctacgaactaaaagaatgcactttcctaaggaccgaaagggttggtatagagactaaaaacaaaattcgaataaattataggttctaaacacataa |
309 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
27836110 |
gtccctacgaactaacagaatgcactttcctaaggaccg-aagggttggtatagagactaaaaacaaaattcaaataaattgtaggttctaaacacataa |
27836012 |
T |
|
| Q |
310 |
ag |
311 |
Q |
| |
|
|| |
|
|
| T |
27836011 |
ag |
27836010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University