View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_152 (Length: 316)
Name: NF1498_low_152
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_152 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 42262169 - 42261873
Alignment:
| Q |
1 |
gattagaattggttgtcttgctatttgatttactttgttaaaaaacaatgcattgggggaagggattatattccttagaggctatgattcaggagaaata |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42262169 |
gattagaattagttgtcttgctatttgatttactttgttaaaaaacaatgcattgggg-aagggattatattccttagaggctatgattcaggagaaata |
42262071 |
T |
 |
| Q |
101 |
cggctctagctatttcttatacaagttttgggtttcacaattctggcactttaaagatgtttgcctttatcaactttctttcaaaatagttactaaatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42262070 |
cggctctagctatttcttatacaagttttgggtttcacaattctggctctttaaagatgtttgcctttatcaactttctttcaaaatagttactagatgt |
42261971 |
T |
 |
| Q |
201 |
tgtgagattatggccaatatgtatatttttactcataagtctaatgactcaaaccctcggtgtgctttaatggagtgtttaggaagggagggaaggac |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
42261970 |
tgtgagattatggccaatatgtatatttttactcataagtctaatgactcaaaccttaggtgtgctttgatggagtgtttaggatgggagggaaggac |
42261873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University