View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_156 (Length: 311)
Name: NF1498_low_156
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_156 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 296
Target Start/End: Complemental strand, 248484 - 248200
Alignment:
| Q |
11 |
cacagaaccaaacacactattaaaaatcacgtcaaatttaatgttaggctcaaatgcactttttgtccctttattttaacttaattgaaattttagtcaa |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
248484 |
cacagaaccaaacacacc-ttaaaaatcacgtcaaatttaatgttaggctcaaatgcactttttgtccctttattttaaattaatcgaaattttagtcaa |
248386 |
T |
 |
| Q |
111 |
ttcatttcaaaaaaccattatttcagtccccttattatacatttcttgggnnnnnnn-agtccccttttagttttagtgatttgtcaatcttgtgttggc |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
248385 |
ttcatttcaaaaa-ccattatttcagtccccttattatacatttcttgggttttttttagtccccttttagttttagtgatttgtcaatcttgtgttggc |
248287 |
T |
 |
| Q |
210 |
tttcttacttttcatgtcattgatagtactttaaaaatgattcatatcaattttggtgatctaacctagtgattaacacgtcataac |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
248286 |
tttcttacttttcatgtcattgatagtactttaaaaatgattcatatcaattttggtgatctaacctagtgagtaacacgtcataac |
248200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 22068929 - 22068886
Alignment:
| Q |
62 |
aaatgcactttttgtccctttattttaacttaattgaaatttta |
105 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
22068929 |
aaatgcacttttgatccccttattttaacttaattgaaatttta |
22068886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University