View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_167 (Length: 299)
Name: NF1498_low_167
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_167 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 53 - 144
Target Start/End: Original strand, 4892499 - 4892590
Alignment:
| Q |
53 |
gtaatattttatctatttatggaaatttttgtgggtgaagtttgtagtatttattatgtagggccgctttgtttaagaatcataaaaatatg |
144 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4892499 |
gtaatattttttctatttatggatatttttgtgtgtgaagtttgtagtatttattatgtagggccgctttgtttaagaatcataaaaatatg |
4892590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 233 - 285
Target Start/End: Original strand, 4892707 - 4892759
Alignment:
| Q |
233 |
aagatcctctatgtgagttatatattatttaaacgcaatctagatactaattc |
285 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
4892707 |
aagatcctctatgtgagttatgtattctttaaacgcaatctagatactaattc |
4892759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University