View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_174 (Length: 292)
Name: NF1498_low_174
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_174 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 3 - 285
Target Start/End: Complemental strand, 39378827 - 39378545
Alignment:
| Q |
3 |
gggtcattaactcaagattttggtggtgattccttgcgttacctgaatgtttcttacaacagattttccggtaaaattccaccggaattcgccgagaaaa |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39378827 |
gggtcattaactcaagattttggcggtgattccttgcgttacttgaatgtttcctacaacagattttccggtgaaattccacgggaattcgccgagaaaa |
39378728 |
T |
|
| Q |
103 |
ttccgagtaacgcaaccgttgatctatcattcaacaatctcactggtgaaataccagagtcccctgttttgttgaaccaggaaacaaaagtgttttctgg |
202 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378727 |
ttcccagtaacgcaaccgttgatctatcattcaacaatctcactggcgaaataccggagtcccctgttttgttgaaccaggaaacaaaagtgttttctgg |
39378628 |
T |
|
| Q |
203 |
taatagtgatctatgtggtgaaccaatgaaaaatccttgttctattccttcttctccttcttctaatcctcaaggttcttctc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378627 |
taatagtgatctatgtggtgaaccaatgaaaaatccttgttctattccttcttctccttcttctaatcctcaaggttcttctc |
39378545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University