View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_177 (Length: 291)
Name: NF1498_low_177
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_177 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0013 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 46 - 242
Target Start/End: Complemental strand, 52153 - 51959
Alignment:
| Q |
46 |
cctatattagtaaaatgaacttgaaaagtaatgttcctacatgctacatcaattatatatttcatctgagaattacattattgttcttgttcctttttta |
145 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153 |
cctatattagtaa--tgaacttgaaaagtaatgttcctacatgctacatcaattatatatttcatctgagaattacattattgttcttgttcctttttta |
52056 |
T |
|
| Q |
146 |
cagtatcatcaatttgattttcatgacactcttcttggcttggggaatcaaacaccgaaataaagaagcagtctctattttgttctctcagatatgg |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52055 |
cagtctcatcaatttgattttcatgacactcttcttggcttggggaatcaaacaccgaaataaagaagcagtctctattttgttctctcagatatgg |
51959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University