View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_185 (Length: 285)
Name: NF1498_low_185
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_185 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 86 - 197
Target Start/End: Original strand, 6748402 - 6748513
Alignment:
| Q |
86 |
attatactcaagaatacctgaaatttgatctcacatttagaaattttaagggagcaagtggatgtacttacatttgggtttcatgtgggggcgggaatgg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6748402 |
attatactcaagaatacctgaaatttgatctcacatttagaaattgtaagggagcaagtggatgtacttacatttgggtttcatgtgggggcgggaatgg |
6748501 |
T |
|
| Q |
186 |
tctatctaaatt |
197 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6748502 |
tctatctaaatt |
6748513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 214 - 267
Target Start/End: Original strand, 6748507 - 6748560
Alignment:
| Q |
214 |
ctaaattctctgctttctaccaaattaatttaaaatgttttctcagggctgtta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6748507 |
ctaaattctctgctttctaccaaattaatttaaaatgttttctcagggctgtta |
6748560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University