View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_190 (Length: 281)
Name: NF1498_low_190
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_190 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 7646373 - 7646631
Alignment:
| Q |
1 |
aagagaaattgaagaagttaaaaacaaacacgataaa-ccattccctaataggatagtaaactgataaatcaatcacatgaagattataaattacgtgat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7646373 |
aagagaaattgaagaagttaaaaacaaacacgataaaaccattccctaataggatagtaaactgataaatcaatcacatgaagattataaattacgtgat |
7646472 |
T |
 |
| Q |
100 |
ttgagctcacccatgttcagtagtttcctttttctcactactagacttttgttgagccttgtccatcttatgtgaagaatcagctttggagcaaaatcta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7646473 |
ttgagctcacccatgttcagtagtttcctttttctcactactagacttttgttgagccttgtccatcttatgtgcagaatcagctttggagcaaaatcta |
7646572 |
T |
 |
| Q |
200 |
acggtggaagtttcccgacaaaggtttgaagagagtgaacgtggaaatgaagcttgtgg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7646573 |
acggtggaagtttcccgacaaaggtttgaagagagtgaacgtggaaatgaagtttgtgg |
7646631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University