View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_195 (Length: 275)
Name: NF1498_low_195
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_195 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 51555249 - 51555464
Alignment:
| Q |
19 |
cttcgaaaaagatcgaatctttaaaccatggagcaacaacgacttgagaaaacagcacaacaacacgaccaagaaaccgaagagattcaacacggtcctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51555249 |
cttcgaaaaagatcgaatctttaaaccatggagcaacaacgacttgagaaaacagcacaacaacacgaccaagaaacggaagagattcaacacggtcctt |
51555348 |
T |
|
| Q |
119 |
tacccgtagaacaacttcaggttaatgggtttctctaaattcatctcttttcttcgtaattttcgtgacccattatttctaatttctttttaggttgacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51555349 |
tacccgtagaacaacttcaggttaatgggtttctctaaattcatctcttttcttcgtaattttcgtgacccattatttctaatttctttttaggttgacc |
51555448 |
T |
|
| Q |
219 |
cgattgttcaaagtgc |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51555449 |
cgattgttcaaagtgc |
51555464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University