View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_210 (Length: 264)
Name: NF1498_low_210
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_210 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 41087338 - 41087541
Alignment:
| Q |
19 |
agtatccctcagttgtattcctttatttggcttcataggtgttgtattgttattgttgcattggatggtgcttactattgcattggaggctattacaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41087338 |
agtatccctcagttgtattcctttatttggcttcataggtgttgtatt------gttgcattggatggtgcttactattgcattgcaggctattacaaat |
41087431 |
T |
 |
| Q |
119 |
aaatttgtgtttttgcttgatgaactcttattttgtttgtgga--nnnnnnnnnaattaattgttagattagttttttctcgtttactcgagtttgaact |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41087432 |
aaatttgtg-gtttgcttgatgaactcttattttgtttgtggatttttttttttaattaattgttagattagttttttctcgtttacccgagtttgaact |
41087530 |
T |
 |
| Q |
217 |
caatacttcaa |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
41087531 |
caatacttcaa |
41087541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 113 - 222
Target Start/End: Original strand, 41089777 - 41089882
Alignment:
| Q |
113 |
acaaataaatttgtgtttttgcttgatgaactcttattttgtttgtggannnnnnnnnaattaattgttagattagttttttctcgtttactcgagtttg |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| || ||| | ||||| |
|
|
| T |
41089777 |
acaaataaatttgcgtttttgcttgatgaactcttattttgtttgtg----tttttttaattaattgttagattatttttttctccttcacttgggtttg |
41089872 |
T |
 |
| Q |
213 |
aactcaatac |
222 |
Q |
| |
|
||||| |||| |
|
|
| T |
41089873 |
aactcgatac |
41089882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 111 - 161
Target Start/End: Original strand, 41076375 - 41076425
Alignment:
| Q |
111 |
ttacaaataaatttgtgtttttgcttgatgaactcttattttgtttgtgga |
161 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41076375 |
ttacaaataattttgtattttttcttgatgaactcttattttgtttgtgga |
41076425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University