View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_211 (Length: 261)
Name: NF1498_low_211
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_211 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 2 - 139
Target Start/End: Complemental strand, 3123317 - 3123180
Alignment:
| Q |
2 |
tatttcttatatatagaagaatcaaaggaaaatggacttatcaacaatgacatattgatggatgagggaagttagggaaaggaaatattgaatgatgaac |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3123317 |
tatttcatatatatagaagaatcaaaggaaaatggacttatcaacaatgacatattgatggatgagggaagttagggagaggaaatattgaatgatgaac |
3123218 |
T |
 |
| Q |
102 |
aactaggtttgtgatagaaattccacttttcaatttgt |
139 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3123217 |
aactaggtttgtgatagaatttccacttttcaatttgt |
3123180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 3123184 - 3123142
Alignment:
| Q |
208 |
tttgtagtacgtgatacgcgtgctcaatgagtagctccttcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3123184 |
tttgtagtacgtgatacgcgtgctcaatgagtagctccttcat |
3123142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 32278372 - 32278435
Alignment:
| Q |
10 |
atatatagaagaatcaaaggaaaatggacttatcaacaatgacata-ttgatggatgagggaagt |
73 |
Q |
| |
|
||||||| |||| |||||||||| || ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32278372 |
atatatataagagtcaaaggaaactg-acttatcaacaatgatataattgatggatgagggaagt |
32278435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University