View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_214 (Length: 260)
Name: NF1498_low_214
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_214 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 249
Target Start/End: Complemental strand, 33327880 - 33327648
Alignment:
| Q |
17 |
agaatcttattggtcagtttcacgtaaaatatgataaactatcacattcacatttcgcttcaatatattgtgcatttctccgcaatccaacaacctttca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
33327880 |
agaatcttattggtcagtttcacgtaaaatatgataaactatcacattcacatttcgcttcaatatattgtgcatttctgcacaatccaataacctttca |
33327781 |
T |
|
| Q |
117 |
atttgaaactataaaacaacttcaataccctacgaaatttatctttgatactatgctaattgagtctgcatctcaaagtcgaaatcagcataacccaata |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33327780 |
atttgaaactataaaacaactacaataccctacaaagtttatctttgatactatgttaattgagtctgcatctcaaactcgaaatcagcataacccaata |
33327681 |
T |
|
| Q |
217 |
acctttcaatttgagactacaaaacaacttcat |
249 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
33327680 |
acctttcaatttgagactacgaaacaacttcat |
33327648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University