View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_226 (Length: 251)
Name: NF1498_low_226
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_226 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 3649568 - 3649353
Alignment:
| Q |
18 |
aacacaagcgttatattcaaagacgttgcgctattatccagttggattcagtggtttaggcaaaaaccattggattagctagccatttcaatagttttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3649568 |
aacacaagcgttatattcaaagacgttgcgctattatccagttggattcagtggtttaggcaaaaaccattggattagctagccatttcaatagttttga |
3649469 |
T |
 |
| Q |
118 |
caatatatgtattatccataaaagacaatnnnnnnnnnnnnnnnnnncaacttagaagcttcgattgaaatatcaagctgctatatatgtgtattggttt |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3649468 |
caatatacgtattatccataaaagacaataaaaacaaaacaaaaaaacaacttagaagcttcgattgaaatatcaagctgctatatatgtgtattggttt |
3649369 |
T |
 |
| Q |
218 |
gtctttcttacaagaa |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3649368 |
gtctttcttacaagaa |
3649353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University