View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_226 (Length: 251)

Name: NF1498_low_226
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_226
NF1498_low_226
[»] chr5 (1 HSPs)
chr5 (18-233)||(3649353-3649568)


Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 3649568 - 3649353
Alignment:
18 aacacaagcgttatattcaaagacgttgcgctattatccagttggattcagtggtttaggcaaaaaccattggattagctagccatttcaatagttttaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
3649568 aacacaagcgttatattcaaagacgttgcgctattatccagttggattcagtggtttaggcaaaaaccattggattagctagccatttcaatagttttga 3649469  T
118 caatatatgtattatccataaaagacaatnnnnnnnnnnnnnnnnnncaacttagaagcttcgattgaaatatcaagctgctatatatgtgtattggttt 217  Q
    ||||||| |||||||||||||||||||||                  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
3649468 caatatacgtattatccataaaagacaataaaaacaaaacaaaaaaacaacttagaagcttcgattgaaatatcaagctgctatatatgtgtattggttt 3649369  T
218 gtctttcttacaagaa 233  Q
    ||||||||||||||||    
3649368 gtctttcttacaagaa 3649353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University