View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_232 (Length: 249)
Name: NF1498_low_232
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_232 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 19475894 - 19476135
Alignment:
| Q |
1 |
cttctcatcgctttcacaatgaggtacaaaattgataactcagtgtctttgccaggccaaatttatattttgtactttctttcaaaacaaaaaatgtctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19475894 |
cttctcatcgctttcacaatgaggtacaaaattgataactcagtgtctctgccaggccaaatttatattttgtactttctttcaaaacaaaaaatgtctg |
19475993 |
T |
 |
| Q |
101 |
cagactgcatgtagtcatggcatttactcttccctttgtatccataagtgttaagaaattactacttctatggttattatcgatgaaagatggacattaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19475994 |
cagactgcatgtagtcatggcatttactcttccctttgtatccataagtattaagaaattactacttctatggttattatcgatgaaagatggacattaa |
19476093 |
T |
 |
| Q |
201 |
cgtgttcgtctatctgcttttctactgatcaaatattcttgg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19476094 |
cgtgttcgtctatctgcttttctactgatcaaatatttttgg |
19476135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University