View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_234 (Length: 249)
Name: NF1498_low_234
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_234 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 4677897 - 4678125
Alignment:
| Q |
1 |
aaagaaaagctactctaatgaagttgtgtagctattcttgatattgtcattaatgactatcaaatacaattgttgcaatctcaatcgtagatgcgatgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4677897 |
aaagaaaagctactctaatgaagttgtgtagctattcttgatattgtcattaatgactatcaaatacaattgttgtaatctcaatcgtagatgcgatgtg |
4677996 |
T |
 |
| Q |
101 |
attacaacaacgaaaataaattatagagttgtggttgctaacctttatttaaaatcttgattatcttgattataatgcaattgcgattttattagctaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4677997 |
attacaacaacgaaaataaattatagacttgtggttgctaacctttatttaaa---------atcttgattataatgcaattgcgattttattagctaga |
4678087 |
T |
 |
| Q |
201 |
taaatggatgatgggaatttactattaatttttatttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4678088 |
taaatggatgatgggaatttactattaatttttatttt |
4678125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 229
Target Start/End: Original strand, 8671163 - 8671200
Alignment:
| Q |
192 |
ttagctagataaatggatgatgggaatttactattaat |
229 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8671163 |
ttagctggataaatgaatgatgggaatttactattaat |
8671200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University