View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_237 (Length: 248)
Name: NF1498_low_237
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_237 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 2896237 - 2896459
Alignment:
| Q |
19 |
ccacatactcatgatttatggctgctcttattttctcaaatatttcttcatgtcttgcatgttccttgtgtccactgtg-aattgtgtcataccatcttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2896237 |
ccacatactcatgatttatggctgctcttattttctcaaatatttcttcatgtcttgcatgttccttgtgtccactgtgcaattgtgtcataccatcttt |
2896336 |
T |
|
| Q |
118 |
tgtttcctcaatcctaaagctttggtcgtggcctatatttacatactacagtaacagcagagcttgtagtactcaatggtcaaattttatgtggaaaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2896337 |
tgtttcctcaatcctaaagctttggtcgtggcctatatttacatactacagtaacagcagagcttgtagtactcaatggtcaaattttatgtggaagata |
2896436 |
T |
|
| Q |
218 |
aaaccataatgccatatcattga |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2896437 |
aaaccataatgccatatcattga |
2896459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University