View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_251 (Length: 242)
Name: NF1498_low_251
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_251 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 223
Target Start/End: Complemental strand, 52972495 - 52972278
Alignment:
| Q |
6 |
tcaaacatgaaattgacacacttaaacctctctatcaaaacctgcttagacaccttgttcccttgttgatgaaggccatctgggttaaggcactgcaaca |
105 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972495 |
tcaaacatggaattgaaacacttaaacctctctctcaaaacctgcttagagaccttgttcccttgttgatgaaggccatctgggttaaggcactgcaaca |
52972396 |
T |
 |
| Q |
106 |
ccttagtccaagtctctctctgataactcttatggtggaacttcaaacttgtttgcctcctcctgcaccagttatcacccatggactcatgaagatcaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52972395 |
ccttagtccaagtctctctctgataactcttatggtggaacttcaaacttgtttgcctcctcctacaccagttatcacccatggactcatgaagatcaac |
52972296 |
T |
 |
| Q |
206 |
acaccctttaatcttttg |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52972295 |
acaccctttaatcttttg |
52972278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University