View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_261 (Length: 238)
Name: NF1498_low_261
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_261 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 1793200 - 1793412
Alignment:
| Q |
11 |
caaagggagtgattaatctcaatcgttttgtcgtccacggtagccctacttgcttagagaagttaatttgtagttgtgtatggatgatatgcgcattctg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
1793200 |
caaagggagtgattaatctcaatcgttttgtcgtccatggtagccctactagctttgagaagttaatttgcagttgtgcgtggaggatatgcgcattctg |
1793299 |
T |
 |
| Q |
111 |
gtttttacaaataatagcattaaaacgataactaaaatgaatagaggaataatattcgattttttctagctacaccctataaactttcagctactccata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
1793300 |
atttttacaaataatagcattaaaacgataactaaaatggatagaggaatagtattcgattttttttagctacaccctataaacgttcagctactccata |
1793399 |
T |
 |
| Q |
211 |
agttgacaaaaat |
223 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
1793400 |
agttgacgaaaat |
1793412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University