View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_261 (Length: 238)

Name: NF1498_low_261
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_261
NF1498_low_261
[»] chr6 (1 HSPs)
chr6 (11-223)||(1793200-1793412)


Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 1793200 - 1793412
Alignment:
11 caaagggagtgattaatctcaatcgttttgtcgtccacggtagccctacttgcttagagaagttaatttgtagttgtgtatggatgatatgcgcattctg 110  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||||  |||| |||||||||||||||    
1793200 caaagggagtgattaatctcaatcgttttgtcgtccatggtagccctactagctttgagaagttaatttgcagttgtgcgtggaggatatgcgcattctg 1793299  T
111 gtttttacaaataatagcattaaaacgataactaaaatgaatagaggaataatattcgattttttctagctacaccctataaactttcagctactccata 210  Q
     |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||    
1793300 atttttacaaataatagcattaaaacgataactaaaatggatagaggaatagtattcgattttttttagctacaccctataaacgttcagctactccata 1793399  T
211 agttgacaaaaat 223  Q
    ||||||| |||||    
1793400 agttgacgaaaat 1793412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University