View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_262 (Length: 238)
Name: NF1498_low_262
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_262 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 34712054 - 34712265
Alignment:
| Q |
11 |
agcaaaggccaaccagaagcaaaaggcaacctgcataatctctgactacgtcccacaaacctgctgccctccacactttcttcccctcttcgcagccaaa |
110 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34712054 |
agcaaaaggcaaccagaagcaaaaggcaacctgcataatctctgactacgtcccacaaacctgctgccctccacactttcttcccctcttcgcagccaaa |
34712153 |
T |
|
| Q |
111 |
aaaggcataccaatcattctcataatttgtttcacattggaaacaactatcagttcattgcacccctc-atcttggagtcgcatacgtgtgggcagcaca |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
34712154 |
aaaggcataccaatcattttcataatttgtttcacattggggacaactatcagttcattgcacccctcgatcttggagttgcatacatgtgggcagcaca |
34712253 |
T |
|
| Q |
210 |
ccgcttaaagct |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34712254 |
ccgcttaaagct |
34712265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University