View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_265 (Length: 238)
Name: NF1498_low_265
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_265 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 214
Target Start/End: Original strand, 11837053 - 11837269
Alignment:
| Q |
6 |
tcgttcactgtgtttatatagtgataaaggctgattaaaacttgtctatacctagtgaaattaagattcagatgaggaag--------aaacaatgaatt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11837053 |
tcgttcactgtgtttatatagtgataaaggctgattaaaacttgtctatacctagtgaaattaagattcagatgaggaagaaccgaagaaacaatgaatt |
11837152 |
T |
 |
| Q |
98 |
atcctttttgtgattgtaacagctacttcatacataacaagttatgatggtaactatacattgcatatacattatttctttttgactgatagcatgtcca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11837153 |
atcctttttgtgattgtaacagctacttcatacataacaagttatgatggtaactatacattgcatatacattatttctttttgactgatagcatgtcca |
11837252 |
T |
 |
| Q |
198 |
cacataacagggtatat |
214 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11837253 |
cacataacagggtatat |
11837269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 206
Target Start/End: Original strand, 14107550 - 14107585
Alignment:
| Q |
171 |
atttctttttgactgatagcatgtccacacataaca |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14107550 |
atttcttttggactgatagcatgtccacacataaca |
14107585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University