View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_276 (Length: 229)
Name: NF1498_low_276
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_276 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 37872560 - 37872763
Alignment:
| Q |
10 |
ccaagaatattaaacttcctatctcttggtcatggaagctctcatatcatgttattatgaaccaactactatctcaaaacatgacatgatatgctacacc |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37872560 |
ccaaaaatattaaacttcctatctcttggtcatggaagctctcatatcatgttat---gaaccaactaccatctctaaacatgacatgatatgctacacc |
37872656 |
T |
|
| Q |
110 |
agtaacaaaataagatcataaacaatattttaactattgcatttgcatgaagcaaccacaagaacattattttaggaagttttatttaaaatcattactg |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37872657 |
agtaacaaaataagatcataaacaaaattttaactattgcatttgcatgaagcaaccacaagaacattattttaggaagttttatttaaaatcattactg |
37872756 |
T |
|
| Q |
210 |
gtgtagc |
216 |
Q |
| |
|
||||||| |
|
|
| T |
37872757 |
gtgtagc |
37872763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University