View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_280 (Length: 227)
Name: NF1498_low_280
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_280 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 28 - 212
Target Start/End: Original strand, 32899788 - 32899974
Alignment:
| Q |
28 |
tcccgtatttattag--tcttactcaaaaactatatatacaagctagagatataaggttagtatataagactactagactattaattgtattgtacaaat |
125 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32899788 |
tcccgtatttattagagtcttactcaaaaactatatatacaagctagagatataaggttagtatataagactactagactattaattgtattgtacaaat |
32899887 |
T |
|
| Q |
126 |
ttgactaacggtttgtgtagacaggtagaaagcttatcaataaatttgaagcatccatttagaaacgatattaaacatcttactctt |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32899888 |
ttgactaacggtttgtgtaggcaggtagaaagcttatcaataaatttgaagcatccatttagaaacgatattaaacgtcttactctt |
32899974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 32120636 - 32120604
Alignment:
| Q |
1 |
tttgccagttgagctaggacttctagatcccgt |
33 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
32120636 |
tttgccagttgagctaggacttctagatgccgt |
32120604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 10096638 - 10096610
Alignment:
| Q |
1 |
tttgccagttgagctaggacttctagatc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10096638 |
tttgccagttgagctaggacttctagatc |
10096610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 44814889 - 44814861
Alignment:
| Q |
1 |
tttgccagttgagctaggacttctagatc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44814889 |
tttgccagttgagctaggacttctagatc |
44814861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 1869841 - 1869813
Alignment:
| Q |
1 |
tttgccagttgagctaggacttctagatc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1869841 |
tttgccagttgagctaggacttctagatc |
1869813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University