View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_285 (Length: 224)
Name: NF1498_low_285
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_285 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 30576641 - 30576453
Alignment:
| Q |
17 |
aatatagcataaggaggtgtttgttaggactaaaggtaagaagtaagtaacattatagtataaggaggagttacttaattgattaattattgagttgcgt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30576641 |
aatatagaataaggaggtgtttgttaggattaaaggtaagaagtaagtaacattatagtataaggaggagttacttaattgattagttattgagttgcgt |
30576542 |
T |
|
| Q |
117 |
gtataaataggagaatggaaggatagggaggaattgagatttgttaatattctgtgaatagatcagtggctctgttgtcgatagggaaa |
205 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30576541 |
gtataaataggagaatggaagtatagggaggaattgagatttgttaatattctgtgaatagatcagtggttctgttgtcgatagggaaa |
30576453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 142
Target Start/End: Original strand, 38760503 - 38760569
Alignment:
| Q |
76 |
ataaggaggagttacttaattgattaattattgagttgcgtgtataaataggagaatggaaggatag |
142 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||| |||| || ||||||||||||||||| ||||||||| |
|
|
| T |
38760503 |
ataaagaggagttagttaattgattagttatagagtagcatgtataaataggagaatagaaggatag |
38760569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University