View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_289 (Length: 222)
Name: NF1498_low_289
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_289 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 61 - 204
Target Start/End: Original strand, 9937564 - 9937701
Alignment:
| Q |
61 |
agaagttaagtttgccttctcatgtgacatttagccacaactagcatcacaaacttcgtttccaaacaacttgccccaaaattcaaattcaaataaaatt |
160 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
9937564 |
agaagttaaatttgccttattatgtgacatttagccacaactagcatcacaaacttagtttccaaacaacttgcccca------aaattcaattaaaatt |
9937657 |
T |
 |
| Q |
161 |
gttgtacaaagaaaacattcatgatttagtaagatgggacaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9937658 |
gttgtacaaagaaaacattcatgatttagtaagatgagacaatt |
9937701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University