View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_296 (Length: 217)
Name: NF1498_low_296
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_296 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 50492272 - 50492077
Alignment:
| Q |
1 |
tcccgattcaccaacctcaccatccgccggtttcaacactgatcaacttcctcacactcacaccagccgcgcatctgaagacgacgaagcttccgttgat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492272 |
tcccgattcaccaacttcaccatccgccggtttcaacactgatcaacttcctcacactcacaccagccgcgcatctgaagacgacgaagcttccgttgat |
50492173 |
T |
 |
| Q |
101 |
cccgatatcattcgcgacgaacccgatccagaggaagaggaagatggagaagatctctacaatgataactttctcgagtcagttcctctatttctc |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50492172 |
cccgatatcattcgcgatgaacccgatccagaggaagaggaagatggagaagatctctacaatgataactttctcgagtcagttcctctatttctc |
50492077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University