View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_299 (Length: 216)
Name: NF1498_low_299
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_299 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 1287710 - 1287895
Alignment:
| Q |
14 |
caaaggaataacatgaattctaaaacttcgacattacatagcaacatactcaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaag |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287710 |
caaaggaataacacgaattctaaaacttcgacattacatagcaacatacttaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaag |
1287809 |
T |
|
| Q |
114 |
agtgtcctcttgcaacctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287810 |
agtgtcctcttgcaacctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagc |
1287895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University