View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_300 (Length: 215)
Name: NF1498_low_300
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_300 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 22 - 107
Target Start/End: Complemental strand, 27181748 - 27181663
Alignment:
| Q |
22 |
tgatatatagacacccttaattctctaacatctatttaacacctcatttttctgtctcaatcttactatcatatcatcaatatatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27181748 |
tgatatatagacacccttaattctctaacatttatttaacaccttatttttctgtctcaatcttactatcatatcatcaatatatt |
27181663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 108 - 173
Target Start/End: Complemental strand, 27181606 - 27181540
Alignment:
| Q |
108 |
aatagatgatgtgatg-caaaagagagaaaatgagaagttaaacgagtgtttcaaacttatatgggt |
173 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27181606 |
aataaatgatgtgatggcaaaagagagaaaatgagaagttaaacgagtgtttcaaacttatatgggt |
27181540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University