View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_306 (Length: 211)
Name: NF1498_low_306
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_306 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 55067184 - 55067373
Alignment:
| Q |
1 |
aacaacttgagtgaaaatttgtgctgggatcaagtgcatta---tactactaggagagagtgtagcatgttaattaaataaaggaattgatgacatgtgg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067184 |
aacaacttgagtgaaaatttgtgctgggatcaagtgcattattatactactaggagagagtgtagcatgttaattaaataaaggaattgatgacatgtgg |
55067283 |
T |
 |
| Q |
98 |
caaagcaaaaggacgtttgttattagcaattagtaatttagtagtagaaggctgagagatggttggtcaggaaagggccaaagtggaaac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55067284 |
caaagcaaaaggacgtttgttattagcaattagtaatttagtagtagaaggctgagagatggttggtcaggaaagggccaaagtggaaac |
55067373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University