View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_309 (Length: 209)
Name: NF1498_low_309
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_309 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 1042436 - 1042644
Alignment:
| Q |
1 |
cttgtgcagcgaggagctgcattgagttgttacttaatcatggtattgaaatcagagggaaaagagttgcaataatcggaaggggtaaaattgcagggtt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042436 |
cttgtgcatcgaggagctgcattgagttgttacttaatcatggtattgaaatcagagggaaaagagttgcaataatcggaaggggtaaaattgcagggtt |
1042535 |
T |
|
| Q |
101 |
accaacttcattgctattgcaggtaacaataaaatgttgttgctgagcagaatgtttcaattgctaaatggctctgattttgccgtcttttgagtagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042536 |
accaacttcattgctattgcaggtaacaataaaatgttgttgctgagcagaatgtttcaattgctaaatggctctgattttgccgtcttttgagtagagg |
1042635 |
T |
|
| Q |
201 |
caccacgcc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
1042636 |
caccacgcc |
1042644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 26 - 142
Target Start/End: Original strand, 1066082 - 1066198
Alignment:
| Q |
26 |
gttgttacttaatcatggtattgaaatcagagggaaaagagttgcaataatcggaaggggtaaaattgcagggttaccaacttcattgctattgcaggta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
1066082 |
gttgttacttaatcatggtattgaaatcagagggaaaaaagttgcaataattggaagggataaaattgttgggttaccggcttcattgctaatgcaggta |
1066181 |
T |
|
| Q |
126 |
acaataaaatgttgttg |
142 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1066182 |
acaataaaatgttgttg |
1066198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University