View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_312 (Length: 205)

Name: NF1498_low_312
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_312
NF1498_low_312
[»] chr3 (1 HSPs)
chr3 (1-194)||(31468098-31468291)
[»] chr5 (3 HSPs)
chr5 (25-93)||(10653236-10653304)
chr5 (1-79)||(7192085-7192163)
chr5 (25-79)||(10661136-10661190)


Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 31468291 - 31468098
Alignment:
1 gaaactgccaaaagttatatcacttagacctttcgcaaaacaatcttagaggaaccataccgatagaggtttttagtctcttctcactaacaaggctatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31468291 gaaactgccaaaagttatatcacttagacctttcgcaaaacaatcttagaggaaccataccgatagaggtttttagtctcttctcactaacaaggctatt 31468192  T
101 ggacttgtcgggaaacttgttgagtggtagtctactacaagaagtaggcaggctagaaaatatcggaaagttgaatttttctgagaataatcta 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31468191 ggacttgtcgggaaacttgttgagtggtagtctactacaagaagtaggcaggctagaaaatatcggaaagttgaatttttctgagaataatcta 31468098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 93
Target Start/End: Complemental strand, 10653304 - 10653236
Alignment:
25 tagacctttcgcaaaacaatcttagaggaaccataccgatagaggtttttagtctcttctcactaacaa 93  Q
    |||||||||| ||||||| |||  ||||||||||||| ||||||||||| ||||| | ||| |||||||    
10653304 tagacctttcacaaaacattctccgaggaaccatacccatagaggttttaagtctttcctccctaacaa 10653236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 7192085 - 7192163
Alignment:
1 gaaactgccaaaagttatatcacttagacctttcgcaaaacaatcttagaggaaccataccgatagaggtttttagtct 79  Q
    |||||||| |||||||| |  || | |||||| | ||||||||||||||||||||||||||  |||| ||||| |||||    
7192085 gaaactgcaaaaagttacaatacctggaccttgcacaaaacaatcttagaggaaccatacccttagaagttttcagtct 7192163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 79
Target Start/End: Complemental strand, 10661190 - 10661136
Alignment:
25 tagacctttcgcaaaacaatcttagaggaaccataccgatagaggtttttagtct 79  Q
    |||||||||| ||||||| |||||||||||||||||| | | |||| ||||||||    
10661190 tagacctttcacaaaacattcttagaggaaccatacccaaaaaggtctttagtct 10661136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University