View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_314 (Length: 204)
Name: NF1498_low_314
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_314 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 34 - 186
Target Start/End: Original strand, 506112 - 506264
Alignment:
| Q |
34 |
ctcatcttaaaagtcggttttgtaaagatgagttaagttctataaaaaacttaataatggccgcatgagctggatttcggttgtgactaatgaaacaact |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
506112 |
ctcatcttaaaagtcggttttgtaaagatgagttaagttatataaaaaacttaataatggccacatgagctggatttcggttgtgactaatgaaacaatt |
506211 |
T |
 |
| Q |
134 |
gatttggaacagatacagtagcccaacaagaattgtggtcctaaccagtgtgt |
186 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506212 |
gatttggaacagatgcagtagcccaacaagaattgtggtcctaaccagtgtgt |
506264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University