View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_317 (Length: 201)
Name: NF1498_low_317
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_317 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 44385439 - 44385277
Alignment:
| Q |
20 |
gagcgattggtccaaaaaataaaggattacttatacttgtccatttactttttgtctttttatttgaacattcattggcaactttcttcgcacttacaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44385439 |
gagcgattggtccaaaaaataaaggattacttatacttgtccatttactttttgtctttttatttgaacattcattggcaactttcttcgcacttacaag |
44385340 |
T |
|
| Q |
120 |
cttttgatgaagtttttggataaagtataagtagatgggtaatgatatttgtatgactattacg |
183 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44385339 |
tttttgatgaagtttttggat-aagtataagtagatgggtaatgatatttgtatgactattacg |
44385277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 49 - 139
Target Start/End: Original strand, 44365370 - 44365460
Alignment:
| Q |
49 |
cttatacttgtccatttactttttgtctttttatttgaacattcattggcaactttcttcgcacttacaagcttttgatgaagtttttgga |
139 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||| |||||||| || |||| |||| ||||||||||||||||||||| |
|
|
| T |
44365370 |
cttatacttatccatttattttttgtctttttatttgaacattcattagcaactttatttgcacctacatgcttttgatgaagtttttgga |
44365460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 47 - 139
Target Start/End: Original strand, 44385619 - 44385709
Alignment:
| Q |
47 |
tacttatacttgtccatttactttttgtctttttatttgaacattcattggcaactttcttcgcacttacaagcttttgatgaagtttttgga |
139 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| | ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
44385619 |
tacttatacttatccatttacttt--gtctttttatttgaacattcatcgacaacttttttcgcacttacaaacttttgatgaagtttttgga |
44385709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University