View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_48 (Length: 466)
Name: NF1498_low_48
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 16 - 355
Target Start/End: Complemental strand, 39210265 - 39209926
Alignment:
| Q |
16 |
atttcaacccttttgggtccgttaggtttggtttgggttcaggtctgggtatttttccctggtttgaatgattttccaagcatatattattgtttgtttt |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39210265 |
atttcaacccttttgggtctgttaggtttggtttgggttcaggtctgggtgtttttccctggtttgaatgattttccaagcagatattattgtttgtttt |
39210166 |
T |
|
| Q |
116 |
attattagtggctccaatgtgcatgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctagaaatgaccgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210165 |
attattagtggctccaatgtgcatgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctagaaatgaccgt |
39210066 |
T |
|
| Q |
216 |
aaaggtttttgatttgatgcactgagttgtaggatgtggatcagtattcgtgttggtggtctggtccattactcacccttaaagatctagattatatgtt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39210065 |
aaaggtttttgatttgatgcactgagttgtaggatgtggatcagtattcgtgttggtggtctggtccattattcatccttaaagatctagattatatgtt |
39209966 |
T |
|
| Q |
316 |
gtaaacattcacccatttcttttttgcaatttggcttcaa |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39209965 |
gtaaacattcacccatttcttttttgcaatttggcttcaa |
39209926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University