View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_75 (Length: 410)
Name: NF1498_low_75
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 158 - 397
Target Start/End: Original strand, 34051466 - 34051705
Alignment:
| Q |
158 |
ggatataagaaatagaaaaacaatttgtttatcaagtccaatattaatagccttgaaagtagttcatgcatcttacgtttaagtaatatgtattcagctc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051466 |
ggatataagaaatagaaaaacaatttgtttatcaagtccaatattaatagccttgaaagtagttcatgcatcttacgtttaagtaatatgtattcagctc |
34051565 |
T |
 |
| Q |
258 |
ttcacccaattaatgtatttacttcctattgtagatagttgcttgctagttgatagtctcttaggccatatgtctatatgaaattgctatggatataggc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051566 |
ttcacccaattaatgtatttacttcctattgtagatagttgcttgctagttgatagtctcttaggccatatgtctatatgaaattgctatggatataggc |
34051665 |
T |
 |
| Q |
358 |
atttataaacttcaaaagaacaataaatctgtcaaagctt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34051666 |
atttataaacttcaaaagaacaataaatctatcaaagctt |
34051705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University