View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1498_low_79 (Length: 408)
Name: NF1498_low_79
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1498_low_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 32125930 - 32125539
Alignment:
| Q |
1 |
tacataaaatacattggttttaacaagactgggacaaacctgaggaatgagttgttcttgaacaacagaagaaggtgaaaactcaatgaaaccagtggca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
32125930 |
tacataaaatacattggttttaagaagactgtgacaaacctgaggaatgagttgttcttgaacaacagaagaaggtgaaaactcagtgaaaccaatggca |
32125831 |
T |
 |
| Q |
101 |
gtgttgtgcacattgagaatttgaggggtgtttgcaggagttggggcaagaagttgcattggagagttaacaaattgaagaaaaggacgaacatccattg |
200 |
Q |
| |
|
|||| ||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32125830 |
gtgtcgtgaacattggggatttgaggggtgtttgcaggagttggggcaagaagttgcattggagagttaacaaattgaagaaaaggacgaacatccattg |
32125731 |
T |
 |
| Q |
201 |
tgagtttagaaatctcagcttcttcttcaactttctgcaaaagggtcttcacttgtcccctcaacaaagcttcaccagaaccaggagtcttcttcacccg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32125730 |
tgagtttagaaatctcagcttcttcttcaactttctgcaaaagggtcttcacttgtcccctcaacaaagcttcaccagaaccaggagtcttcttcacccg |
32125631 |
T |
 |
| Q |
301 |
gcttcccctttgctttgcaatactcgacagaggtgtctcaatctcgccattcgcaaggccaacgatgggagaatcattggatatgtcgatca |
392 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32125630 |
gcttcctctttgcttcgcaatactcgacagaggtgtctcaatctcgccattcgcaaggccaacgatgggagaatcattggatatgtcgatca |
32125539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 221 - 312
Target Start/End: Original strand, 8621485 - 8621576
Alignment:
| Q |
221 |
tcttcttcaactttctgcaaaagggtcttcacttgtcccctcaacaaagcttcaccagaaccaggagtcttcttcacccggcttcccctttg |
312 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||| ||| ||||||||||| || || || |||||||| || ||||| ||||| |
|
|
| T |
8621485 |
tcttcttcaaccatctgcataagggtcttcacttgacccctcagcaaggcttcaccagatcctggtgtgttcttcacacgacttcctctttg |
8621576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University