View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14990_high_4 (Length: 298)
Name: NF14990_high_4
Description: NF14990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14990_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 15 - 283
Target Start/End: Complemental strand, 53558046 - 53557778
Alignment:
| Q |
15 |
catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattactgtaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53558046 |
catagggttgttattagagttttgaaggctaatttggatcattttttcttgagaaggatgcaactttggccaaactagtgcagcagggttattattgtaa |
53557947 |
T |
 |
| Q |
115 |
aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaatttgaataagaattctcatctattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53557946 |
aaagacaaagggttttgaaggctttgaagttgcatatgaagttgaagtctctcaagagctgagctacttaatgaatttgaataagaattctcatctattc |
53557847 |
T |
 |
| Q |
215 |
catttgtgtccttttggttcatcaagctgttgttgatatttgactgttttcgctttccgagtaatttct |
283 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
53557846 |
catttgtgtccttttggttcatcaagcagttgtttatattcgactgttttcgctttccgagtaatttct |
53557778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University